GSTM1 (Homo sapiens ) in pMCSG7 (His-tagged bacterial expression vector)

Explanation of Terms


Gene: Gene Symbol:  GSTM1
Gene Name:  glutathione S-transferase mu 1
Sequence              		HsCD00343171

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: SPTA
Original Clone ID: NCI10460
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pMCSG7               Format:  CLOSED
Source: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer
Description: None
Comments: None
Mutation/
Discrepancy :		 No / No
Publications: None
Authors: Argonne National Laboratory and National Cancer Institute Clinical Proteomic Technologies for Cancer

 

Insert sequence: 657nts         Open reading frame : 1 to 657 

ATGCCCATGATACTGGGGTACTGGGACATCCGCGGGCTGGCCCACGCCATCCGCCTGCTC
CTGGAATACACAGACTCAAGCTATGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGAT
TATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAATCTG
CCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCCATCTTGTGCTACATT
GCCCGCAAGCACAACCTGTGTGGGGAGACAGAAGAGGAGAAGATTCGTGTGGACATTTTG
GAGAACCAGACCATGGACAACCATATGCAGCTGGGCATGATCTGCTACAATCCAGAATTT
GAGAAACTGAAGCCAAAGTACTTGGAGGAACTCCCTGAAAAGCTAAAGCTCTACTCAGAG
TTTCTGGGGAAGCGGCCATGGTTTGCAGGAAACAAGATCACTTTTGTAGATTTTCTCGTC
TATGATGTCCTTGACCTCCACCGTATATTTGAGCCCAACTGCTTGGACGCCTTCCCAAAT
CTGAAGGACTTCATCTCCCGCTTTGAGGGCTTGGAGAAGATCTCTGCCTACATGAAGTCC
AGCCGCTTCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAG

Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Mutations:
None 		Discrepancy:
None
5' Linker Sequence: 
TCCAATGCC
3' Linker Sequence: None

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  ampicillin
Bacterial Selection Condition:  100 ug/mL ampicillin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Commonly used conditions for ampicillin resistant plasmid clones.
Protein Expression Results: ProteinExpressed: Protein_Confirmed
ProteinPurified: Protein_Confirmed
SolubleProtein: Protein_Confirmed
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius
Vector Name: pMCSG7
Synonyms: pMCSG-7
Description: Bacterial expresson vector with T7 promoter, adds N-terminal His tag and TEV protease site; amp resistance; ligation independent cloning (LIC).
Comments: pET21 derivative; for routine HTP purification
Size (bp): 5286
Parent Vector: None
Empty Vector: EvNO00084271
Properties: bacterial expression, in vitro transcription, ligation independent cloning (LIC), with tag/fusion/marker
Author Name: MCSG
Publications: PMID: 12071693
Title: A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site

PMID: 18988021
Title: A family of LIC vectors for high-throughput cloning and purification of proteins.
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
MCS LIC ligation-independent cloning (LIC) region 204 235
bacterial origin ori ColE1 pBR322-type bacterial origin of replication 3280 3280
promoter T7 T7 promoter 360 376
protease cleavage site TEV TEV cleavage site cds 223 243
repressor binding site lac operator LacO fragment 335 357
repressor protein gene LacI LacI coding region 890 1849
selectable marker AmpR ampicillin resistance gene 4038 4898
tag His 2 N-terminal 6xHis tag 268 285
tag His C-terminal 6xHis tag 140 157
trxn termination sequence T7 term T7 terminator sequence 26 72

 


Cloning Information: 562529
GI: 306812
GenBank Accession: J03817
HIP Master Clone ID: 472847
Labome: GSTM1-antibody
Labome: GSTM1-antibody-review
Original Clone ID: NCI10460
UniProt: P09488
Species Specific ID: 2944
Target GenBank: J03817