UBE2C (Homo sapiens ) in pDONR221 (Gateway donor/master vector)

Explanation of Terms


Gene: Gene Symbol:  UBE2C
Gene Name:  ubiquitin-conjugating enzyme E2C
Sequence              Map: pDONR cofig.pdf
 HsCD00041380

Price:  Login for Pricing
AVAILABLE
No restriction
Special MTA: None

Original Clone ID: FLH186146.01L
Keyword: None
Species: Homo sapiens
Type: cDNA
Vector Name: pDONR221               Format:  FUSION
Source: HIP
Description: None
Comments: None
Mutation/
Discrepancy :		 No / No
Publications: None
Authors: HIP

 

Insert sequence: 540nts         Open reading frame : 1 to 540 

ATGGCTTCCCAAAACCGCGACCCAGCCGCCACTAGCGTCGCCGCCGCCCGTAAAGGAGCT
GAGCCGAGCGGGGGCGCCGCCCGGGGTCCGGTGGGCAAAAGGCTACAGCAGGAGCTGATG
ACCCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTC
AAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAG
CTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACG
CCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAA
AAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGA
GAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACA
GCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGCCAGGAGCCCTTG

Coding Sequence Details
Insert Sequence Verified?: Y Verification Method: Sequence Verification
Reference Sequence Annotations:
End on reference sequence 589
Start on reference sequence 50
Mutations:
None 		Discrepancy:
None
5' Linker Sequence: 
5p GTACAAAAAAGCAGGCTCCACC(atg-goi)
3' Linker Sequence: 
5p (goi-stop)GACCCAGCTTTCTTGTAC

 

 Recommended Growth Condition:

Distributed in bacterial strain : DH5-alpha T1 phage resistant
Antibiotic Selection: Host Type:  bacterial    Marker:  kanamycin
Bacterial Selection Condition:  50ug/mL kanamycin
Growth Condition:  Growth with the single antibiotic in LB at 37 degrees is recommended.
Comments:  Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors.
Protein Expression Results: None
Recommended expression in: Not Applicable
       DyNA Vector Map

         Powered by LabGenius
Vector Name: pDONR221
Synonyms: None
Description: Recombinational donor/master vector with M13 F and R primer sites; kanamycin resistance; recombinational cloning.
Comments: The position of features were determined for the unrecombined (empty) form of the vector, which is described in detail on the Invitrogen website.
Size (bp): 4762
Parent Vector: None
Empty Vector: None
Properties: Gateway, donor (entry), recombinational cloning
Author Name: Invitrogen
Publications: None
Vector Map:         Vector Sequence:
Sequence:



Vector Features:

Type Name Description Start Position End Position
bacterial origin ColE1 ColE1 (pUC-type) origin of replication 4086 4759
negative selection marker ccdB ccdB negative selection gene (death cassette), LOST in recombined (with insert) form 1502 1197
primer site M13 forward primer M13 Forward priming site 537 552
primer site M13 reverse primer M13 Reverse priming site 3027 3034
recombination site attP1 attP recombination site 1 LOST in recombined (with insert) form 570 801
recombination site attL1 attL recombination site 1 present in recombined (with insert) form only, position is approximate 570 801
recombination site attL2 attL recombination site 2 present in recombined (with insert) form only, position is approximate 2985 2754
recombination site attP2 attP recombination site 2 LOST in recombined (with insert) form 2985 2754
selectable marker CmR chloramphenicol resistance gene, LOST in recombined (with insert) form 2506 1847
selectable marker KanR kanamycin resistance gene 3156 3965
trxn termination sequence rrnB T2 rrnB T2 transcription termination sequence 295 268
trxn termination sequence rrnB T1 rrnB T1 transcription termination sequence 470 427

 


Cloning Information: 186146
HIP Master Clone ID: 161090
Labome: UBE2C-antibody
Labome: UBE2C-antibody-review
Original Clone ID: FLH186146.01L
UniProt: E1P5N7
UniProt: A6NP33
UniProt: O00762
UniProt: A6NKY3
UniProt: Q5TZN3
Species Specific ID: 11065
Target GenBank: BC016292