Detailed Information
Clone: TvCD00084286
| Clone ID: | TvCD00084286 | Type: | cDNA |
|---|---|---|---|
| Is Verified: | N | Verification Method: | |
| Status: | AVAILABLE | Distribution: | No restriction |
| Source: | CESG | Special MTA: | PSI |
| Description: | E. coli expression vector; expresses mutated form of MBP-T7 tagged TEV protease; MBP portion of the fusion is removed in vivo by autocleavage; kanamycin resistance | ||
| Comments: | expresses MBP-His tagged TEV protease | ||
| Map: | MHT_Map.pdf | ||
Additional Annotations:
Please note that clicking on the HIP Clone ID will link to additional sequencing information including the linker sequences (the sequences immediately flanking the insert).
Collection/Protein Expression Information:
| Collection | Center for Eukaryotic Structural Genomics | |
|---|---|---|
| Collection | PSI | |
| Collection | University of Wisconsin |
Insert Information:
Insert Sequence:
Insert: 1
GTGCCGGGCTGGAAGTTCTGTTCCAGGGGCCCGAAAACCTGTACTTCCAGGCGATCGCCC ATCATCATCATCATCATCATGGAGAAAGCTTGTTTAAGGGGCCGCGTGATTACAACCCGA TATCGAGCTCCATTTGTCATTTGACGAATGAATCTGATGGGCACACAACATCGTTGTATG GTATTGGATTTGGTCCCTTCATCATTACAAACAAGCACTTGTTTAGAAGAAATAATGGAA CACTGTTGGTCCAATCACTACATGGTGTATTCAAGGTCAAGGACACCACGACTTTGCAAC AACACCTCGTTGATGGGAGGGACATGATAATTATTCGCATGCCTAAGGATTTCCCACCAT TTCCTCAAAAGCTGAAATTTAGAGAGCCACAAAGGGAAGAGCGCATATGTCTTGTGACAA CCAACTTCCAAACTAAGAGCATGTCTAGCATGGTGTCAGACACTAGTTGCACATTCCCTT CATCTGATGGCATATTCTGGAAGCATTGGATTCAAACCAAGGATGGGCAGTGTGGCAGTC CATTAGTATCAACTAGAGATGGGTTCATTGTTGGTATACACTCAGCATCGAATTTCACCA ACACAAACAATTATTTCACAAGCGTGCCGAAAAACTTCATGGAATTGTTGACAAATCAGG AGGCGCAGCAGTGGGTTAGTGGTTGGCGATTAAATGCTGACTCAGTATTGTGGG
Coding Sequence Location, Mutations, and Discrepancies: Insert 1
Click here for more information about how mutations and discrepancies are defined and notated at DNASU.
| Type | Value | Extra Information |
|---|
Vector Information:
| Vector Name: | pMHTDelta238 | Size (bp): | 5777 |
|---|---|---|---|
| Type: | bacterial plasmid | Form: | dsDNA |
| Description: | E. coli expression vector; expresses mutated form of MBP-T7 tagged TEV protease; MBP portion of the fusion is removed in vivo by autocleavage; kanamycin resistance | ||
| Properties: | bacterial expression, with tag/fusion/marker | ||
| Comments: | MBP portion of the TEV fusion is removed in vivo by autocleavage leaving a His tagged TEV | ||
| Map: | MHT_Map.jpg | ||
| Sequence: | pMHTDelta238.pdf | ||
Host Information:
| Host Strain | Is Used In Distribution | Description |
|---|---|---|
| DH5-alpha T1 phage resistant | Y | phage-resistant E. coli DH5-alpha strain used by HIP |
Antibiotic Selections:
| Host Type | Marker |
|---|---|
| bacterial | kanamycin |
Recommended Growth Condition:
| Host Type | Selection Condition | Growth Condition | Comments |
|---|---|---|---|
| bacterial | 50ug/mL kanamycin | Growth with the single antibiotic in LB at 37 degrees is recommended. | Conditions for Gateway-type vectors in recombined (with insert) form and other kanamycin resistant vectors. |
Authors:
| Author Name | Author Type |
|---|---|
| PSI | Initiative |
| Center for Eukaryotic Structural Genomics | PSI Center |
| University of Wisconsin | Academic Institute |
Publications:
| PMID | Title |
|---|